Files in this item
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Item metadata
dc.contributor.author | Abella, M | |
dc.contributor.author | Rodriquez, S | |
dc.contributor.author | Paytubi, S | |
dc.contributor.author | Campoy, S | |
dc.contributor.author | White, Malcolm Frederick | |
dc.contributor.author | Barbe, J | |
dc.date.accessioned | 2013-12-05T13:01:05Z | |
dc.date.available | 2013-12-05T13:01:05Z | |
dc.date.issued | 2007-11 | |
dc.identifier.citation | Abella , M , Rodriquez , S , Paytubi , S , Campoy , S , White , M F & Barbe , J 2007 , ' The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein ' , Nucleic Acids Research , vol. 35 , pp. 6788-6797 . https://doi.org/10.1093/nar/gkm782 | en |
dc.identifier.issn | 0305-1048 | |
dc.identifier.other | PURE: 397715 | |
dc.identifier.other | PURE UUID: 81989364-da25-4614-b6c6-70a8d140d735 | |
dc.identifier.other | WOS: 000251336000014 | |
dc.identifier.other | Scopus: 36749045679 | |
dc.identifier.other | ORCID: /0000-0003-1543-9342/work/47136099 | |
dc.identifier.uri | http://hdl.handle.net/10023/4275 | |
dc.description.abstract | Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression. | |
dc.format.extent | 10 | |
dc.language.iso | eng | |
dc.relation.ispartof | Nucleic Acids Research | en |
dc.rights | © 2007 The Author(s). This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. | en |
dc.subject | LRP-LIKE PROTEIN | en |
dc.subject | ARCHAEON SULFOLOBUS | en |
dc.subject | GENE-EXPRESSION | en |
dc.subject | BINDING PROTEIN | en |
dc.subject | TRANSCRIPTION | en |
dc.subject | REPAIR | en |
dc.subject | MECHANISM | en |
dc.subject | CLEAVAGE | en |
dc.subject | P2 | en |
dc.title | The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein | en |
dc.type | Journal article | en |
dc.contributor.sponsor | BBSRC | en |
dc.description.version | Publisher PDF | en |
dc.contributor.institution | University of St Andrews. School of Biology | en |
dc.contributor.institution | University of St Andrews. Biomedical Sciences Research Complex | en |
dc.identifier.doi | https://doi.org/10.1093/nar/gkm782 | |
dc.description.status | Peer reviewed | en |
dc.identifier.url | http://www.scopus.com/inward/record.url?scp=36749045679&partnerID=8YFLogxK | en |
dc.identifier.url | http://nar.oxfordjournals.org/content/35/20/6788 | en |
dc.identifier.grantnumber | BB/C000110/1 | en |
This item appears in the following Collection(s)
Items in the St Andrews Research Repository are protected by copyright, with all rights reserved, unless otherwise indicated.